
DNAConverter
Mutual conversion tool
USD 0.99 · Designed for iPad
Want to say something, but also… not really?
This app lets you hide those feelings inside ATCG.
If saying “thank you” directly feels awkward, or being honest feels too embarrassing, just convert your message into a DNA-style ATCG sequence with this app.
■Text → Nucleotide Sequence
“Thank you” becomes something like TTTATCCATCATTCGCTCCGACAATGCTTCGGTGTT unnecessarily long and mysteriously meaningful!
Send it to someone and they won’t understand a thing, but you can feel satisfied that you “expressed your gratitude.”
■Nucleotide Sequence → Text
Even ATCG-only cryptic messages can be decoded back to the original text.
Perfect for private “secret code” chats among friends.
■Features
• Generates DNA-like sequences instantly, even though they mean nothing
• Copy & paste into messaging apps for quick sharing
• Decode mode for conversations only insiders can understand
• Absolutely no biological meaning whatsoever
Even the words you can’t say out loud might feel lighter when you hide them in ATCG.
Ratings & Reviews
This app has not received enough ratings or reviews to display an overview.
App design refreshed!
The developer, makoto amijima, indicated that the app’s privacy practices may include handling of data as described below. For more information, see the developer’s privacy policy .
Data Not Collected
The developer does not collect any data from this app.
Accessibility
The developer has not yet indicated which accessibility features this app supports. Learn More
Information
- Seller
- makoto amijima
- Size
- 1.3 MB
- Category
- Utilities
- Compatibility
Requires iOS 26.0 or later.
- iPhone
Requires iOS 26.0 or later. - iPad
Requires iPadOS 26.0 or later. - Mac
Requires macOS 26.0 or later and a Mac with Apple M1 chip or later. - Apple Vision
Requires visionOS 26.0 or later.
- Languages
English and 9 more
- English, Arabic, French, Indonesian, Japanese, Malay, Portuguese, Russian, Spanish, Traditional Chinese
- Age Rating
4+
- 4+
- Copyright
- © 2025 am10
